Week 14 & 15 AnalysisSecondary PCR was re-performed using the secondary PCR sample that produced a band in the previous week's figure. This method was suggested by Dr. B. As seen in Figure 1, Lane 4 appears to have a distinct band around the 1500 bp mark which was expected since the gene size for the protein is 1407bp. Using the sample from lane 4, PCR^2 was preformed and the results can be seen in Figure 2. Unfortunately, there were no distinct bands in each of the 4 lanes loaded with sample which means a fatal error must have occurred throughout the procedure. The next step would be to re-perform PCR^2 making sure serial techniques are performed and calculations are correct. Some sample was also lost while loading lanes.
Figure 2: 1% agarose gel with 1xTAE buffer. L1: skipped. 1kb: 1kb DNA kb ladder. L2: 10 uL of sample 1 from PCR^2 with 2 uL of blue juice. L3: 10 uL of sample 2 from PCR^2 with 2 uL of blue juice. L4: 10 uL of sample 3 from PCR^2 with 2 uL of blue juice. L5: 10 uL of sample 4 from PCR^2 with 2 uL of blue juice.
Figure 1: 1% agarose gel with 1xTAE buffer. L1: skipped. L2: 1kb DNA ladder L3: 10 uL sample of primary PCR product with 2 uL of blue juice (Sample 1). L4: 10 uL sample of primary PCR product with 2 uL of blue juice (Sample 2).
Week 11,12 & 13 12042014- Great work 11/11/14
Figure 4: 1% agarose gel with 1xTAE buffer. L1: skipped. L2: skipped. 1kb Lane: 1 kb DNA ladder. L3: 10 uL sample of primary PCR product using Gio's oligo mix with 2 uL of blue juice (Sample 1). L4: 10 uL sample of primary PCR product using Gio's oligo mix with 2 uL of blue juice (Sample 2). L5: 10 uL sample of secondary PCR product with 2 uL of blue juice (Sample 1). L6: 10 uL sample of secondary PCR product with 2 uL of blue juice (Sample 2).
AnalysisPrimary PCR was performed using my partner's oligo mix and two samples were attained as seen in L3 and L4 of Figure 4. From these products, secondary PCR was performed and two samples were also attained and ran in lanes L5 and L6 of Figure 4. According to the gel, primary PCR was quite successful as seen with the smears in lanes L3 and L4. There are some questionable aspects of the smears since they did not reach the ladder's marker that pertains to the DNA sequence's size. The secondary PCR products attained from the primary produced unsuccessful results. Although, in L5 which cannot be seen quite clearly here, there was a slight band at the correct DNA marker for the protein's size. The next step, as suggested by Dr. B, will be to re-run secondary PCR using the secondary PCR product used in lane 5 rather than the primary product in hopes of creating more DNA at the correct size that can produce a stronger band. 11/7/14
Figure 3: 1% Agarose gel with 1xTAE buffer. L1: Skipped. 1kb Lane: 1 kb DNA ladder. L2: 10 uL sample of secondary PCR product with 2 uL of blue juice (65 C). L3: 10 uL sample of secondary PCR product using Gio's primary with 2 uL of blue juice. L4: 10 uL sample of secondary PCR product using Gio's primary with 2 uL blue juice.
Figure 2: 1% agarose gel with 1xTAE buffer. L1: skipped. 1kb Lane: 1kb DNA ladder. L2: 10 uL sample of secondary PCR product with 2 uL of blue juice (58 C). L3: 10 uL sample of secondary PCR product with 2 uL of blue juice (59 C). L4: 10 uL sample of secondary PCR product with 2 uL of blue juice (60 C). L5: 10 uL sample of secondary PCR product with 2 uL of blue juice (61 C). L6: 10 uL sample of secondary PCR product with 2 uL of blue juice (62 C). L7: 10 uL sample of secondary PCR product with 2 uL of blue juice (63 C). L8: 10 uL sample of secondary PCR product with 2 uL of blue juice (64 C).
AnalysisA fifth trial of secondary PCR was performed and two gels were made. In this trial, a temperature gradient was performed for the annealing step using the temperatures found in the tail primer design protocol. Eight temperatures were used in this gradient ranging from 58-65C and can be seen in L2-L8 of Figure 2 and in L2 of Figure 3. Secondary PCR was also performed using my partner's primary samples that gave him prominent bands in secondary which can be see in Figure 3, L3 and L4. Unfortunately there were no brands present in either of the gels. This is possibly due to a defect in the primary I've used or even the oligo mix since my primary results were quite questionable with respect to the low smearing. A highly possible reason my partner's primary didn't result in a band can be due to the fact that I used the wrong samples since they're were several samples labled primary. The next step would be to start over and re-do my oligo mix to get a stronger primary or to find the correct sample from my partner. 11/3/14
Figure 1: 1% agarose gel with 1xTAE buffer. Lane 1: Skipped. 1kB Lane: 1kB DNA ladder. L2: 10 uL sample of secondary PCR product with 2 uL of blue juice
Analysis
A fourth trial of secondary PCR was performed using NEB guidelines again but this time the elongation time was targeted by the addition of 15 seconds to the highest number given for the elongation time (30s) which resulted in a total of 45s for the elongation time. This strategy was used after unsuccessfully targeting the annealing time which was seen in last weeks's work. The elongation time was also targeted since both partners achieved success in secondary PCR using this method. This is also due to the fact that the DNA sequence is 1407bp and may need longer time to finish elongating since it is quite large. 1162014- Include more picturesWeek 8,9 & 10 PCR trial 3 for target PF6PGD
Figure 1: 1% agarose gel with 1xTAE buffer after results of secondary PCR. Lane 1: Skipped. Lane 2: 1kb DNA ladder. Lane 3(labeled L2): 10uL of sample and 2 uL of blue juice.
Analysis The third trial of PCR resulted in no bands as seen in Figure 1. In this trial, NEB guidelines were used for secondary PCR with the addition of 5 seconds to the highest numbers given for the annealing step (10-30s) which resulted in 35s for this step. Unfortunately their were no results seen after running the gel. In the fourth trial, NEB guidelines were also used along with the highest numbers for each step. In the fourth trial, the elongation step was targeted and an additional 15 seconds was added to the the step. Elongation step was targeted due to the fact that the sequence was quite large in length (1407 base pairs) and more time may be needed for this step. The elongation step also targeted because a lab partner had success using the same method. The gel has not been ran to confirm any results but will be ran at the beginning of the week.
9232014- Great analysis Lauren Week 5,6 & 7 PCR trials 1 & 2 for target PF6PGD
Figure 2: 1% agarose gel with 1xTAE buffer after results of first PCR for primary. Lane 1: 1kb DNA ladder. Lane 2: Trial 1 of primary PCR results of PF6PGD containing 10 uL of sample and 2 uL of blue juice (sample repeated from first gel) Lane 3: Sample 1 of Trial 2 of primary PCR results of PF6PGD containing 10 uL of sample and 2 uL of blue juice. Lane 4: Sample 2 of Trial 2 of primary PCR results of PF6PGD containing 10 uL of sample and 2 uL of blue juice. Lane 5-8: Lab mates' PCR samples (With respect to skipping first lane of well)
Figure 1: 1% agarose gel with 1xTAE buffer after results of first PCR for primary. Lane 1: 1kb DNA ladder. Lane 2: Primary PCR results of PF6PGD containing 10 uL of sample and 2 uL of blue juice. Lane 3-6: Lab mates' PCR samples. (With respect to skipping first lane of well)
Analysis:The first attempt at primary PCR failed as seen in lane 2 of Figure 1 which displayed no smear. In the second attempt at primary PCR, two samples were made and inserted into lanes 3 and 4 of the second gel as seen in Figure 2. Lane 4 showed a slight smear but was questioned due to the length of the smear and the fact that it was located heavily at the bottom which is not quite right for a 1407 base pair DNA sequence. Results will be confirmed after performing secondary PCR and rerunning the sample in lane 4. If a band appears in secondary PCR then the next step would be PCR squared for amplification, if not then adjustments must be made to the protocol such as the annealing temperature or possibly the annealing time since it is a large sequence.
Plasmid Midi-Prep for pNIC-Bsa4
Figure 2: 2 uL sample of pNIC-Bsa4 after midi-prep with a yield of 28.1 ng/uL. Measurement 2.
Figure 1: 2 uL sample of pNIC-Bsa4 after midi-prep with a yield of 24.9 ng/uL. Measurement 1.
Analysis:Midi-prep for pNIC-Bsa4 was performed in order to purify the plasmid for DNA cloning. An average yield of 26.5 ng/uL was obtained for plasmid pNIC-Bsa4 which is not ideal for the cloning the process. Error occurred when elution was plunged into the waste flask instead of the conical tube for collection. Half of the elution was lost before realizing the mistake which resulted in a low yield of plasmid. Midi-prep will be performed again in order to achieve the desired yield of ~50 ng/uL. After achieving a desirable yield of plasmid, the next step will to be to use it for RE digest. Primer Tail Design
Figure 1: Custom digest of pNIC-Bsa4 with BsaI from NEBcutter
Reverse Primer:
5' ACTATCATACCCTGTGGTAACAGTAAAGGTGGATA 3' AnalysisA virtual plasmid was created using pNIC-Bsa4 and was digested with BsaI via NEBcutter in order to find where the insertion can be made for the CDS. After removal of SacB gene, the CDS can be inserted. Primer tails were also designed and ordered which will be needed for secondary PCR in order to create a full gene that can be amplified later for cloning. 09232014- Nice work, however you might want to elaborate more on your analysisWeek 3 & 4 Analysis:Agarose gel produced after PCR. Lane 2 missing due to error in loading lane. PCR
Figure 1: 1% Agarose gel with 1xTAE buffer of plasmid pGBR22 after PCR. Lane 1: 1 kb DNA ladder. Lane 2: Sample A (0.3 ng). Lane 3: Sample B (3 ng). Lane 4: Sample C (30 ng). Lane 5: Sample D (0 ng).
Analysis:
Agarose gel after RE digest using restriction enzymes to cut the plasmid producing different segments of the DNA.
RE Digest
Figure 1: 1% Agarose gel with 1xTAE buffer of plasmid pGBR22 for RE Digest. Lane 1: Skipped. Lane 2: 1 kb DNA ladder. Lane 3: Uncut pGBR22 plasmid. Lane 4: EcoRI digestion enzyme. Lane 5: PvuII digestion enzyme. Lane 6: EcoRI + PvuII digestion enzymes.
Analysis
After overnight incubation and spin down, pellets (not pictured) were stored in the -20C freezer. The next step is the purification process.
Day 2 & 3 of Transformation: plasmid pNICBsa4
Figure 2: 37 ml LB containing 80ul of 50ug/ml of Kan and DH5alpha E. coli competent cells with plasmid pNIC-Bsa4. Overnight incubation at 37C.
Figure 1: 80ml LB containing 80ul of 50ug/ml of Kan and DH5 alpha E. Coli competent cells with plasmid pNIC-Bsa4. Incubated in 37C shaker at 200 rpm for appx 16 hours
090814 - Good job Lauren.
Week 1 & 2
Analysis:
As seen if Figures 3 and 4, bacterial growth was present after overnight incubation. In order to confirm transformation, further analysis must be made. Next step in the process will be to over-express the protein.
Figure 4: LB + Kan plate containing DH5 alpha E. coli competent cells - DNA plasmid pNIC-Bsa4-50uL after overnight incubation at 37C.
Figure 3: LB + Kan plate containing DH5 alpha E. coli competent cells - DNA plasmid pNIC-Bsa4-10uL after overnight incubation at 37C.
Analysis:
Both graphs as seen in Figure 1 and 2 are consistent in illustrating peaks at 260nm which is the maximum wavelength DNA absorbs light at. Ratios at 260/280 are both close to 1.8, the desired ratio. These values indicate the purity in relation to protein which are both sufficient numbers. Ratios at 260/230 are also close to the number desired, 2.1 which correlates to the purity in relation to other contaminants. Both trials show fairly conclusive results.
Figure 2: Trial 2 of 2uL sample of pGBR22 with absorbance of 2.161 at 230nm wavelength. Peaking at 260nm.
Figure 1: Trial 1 of 2uL sample of pGBR22 with absorbance reading of 2.274 at 230nm wavelength. Peaking at 260nm.
AnalysisSecondary PCR was re-performed using the secondary PCR sample that produced a band in the previous week's figure. This method was suggested by Dr. B. As seen in Figure 1, Lane 4 appears to have a distinct band around the 1500 bp mark which was expected since the gene size for the protein is 1407bp. Using the sample from lane 4, PCR^2 was preformed and the results can be seen in Figure 2. Unfortunately, there were no distinct bands in each of the 4 lanes loaded with sample which means a fatal error must have occurred throughout the procedure. The next step would be to re-perform PCR^2 making sure serial techniques are performed and calculations are correct. Some sample was also lost while loading lanes.
Week 11,12 & 13
12042014- Great work
11/11/14
Analysis Primary PCR was performed using my partner's oligo mix and two samples were attained as seen in L3 and L4 of Figure 4. From these products, secondary PCR was performed and two samples were also attained and ran in lanes L5 and L6 of Figure 4. According to the gel, primary PCR was quite successful as seen with the smears in lanes L3 and L4. There are some questionable aspects of the smears since they did not reach the ladder's marker that pertains to the DNA sequence's size. The secondary PCR products attained from the primary produced unsuccessful results. Although, in L5 which cannot be seen quite clearly here, there was a slight band at the correct DNA marker for the protein's size. The next step, as suggested by Dr. B, will be to re-run secondary PCR using the secondary PCR product used in lane 5 rather than the primary product in hopes of creating more DNA at the correct size that can produce a stronger band.
11/7/14
Analysis A fifth trial of secondary PCR was performed and two gels were made. In this trial, a temperature gradient was performed for the annealing step using the temperatures found in the tail primer design protocol. Eight temperatures were used in this gradient ranging from 58-65C and can be seen in L2-L8 of Figure 2 and in L2 of Figure 3. Secondary PCR was also performed using my partner's primary samples that gave him prominent bands in secondary which can be see in Figure 3, L3 and L4. Unfortunately there were no brands present in either of the gels. This is possibly due to a defect in the primary I've used or even the oligo mix since my primary results were quite questionable with respect to the low smearing. A highly possible reason my partner's primary didn't result in a band can be due to the fact that I used the wrong samples since they're were several samples labled primary. The next step would be to start over and re-do my oligo mix to get a stronger primary or to find the correct sample from my partner.
11/3/14
Analysis
A fourth trial of secondary PCR was performed using NEB guidelines again but this time the elongation time was targeted by the addition of 15 seconds to the highest number given for the elongation time (30s) which resulted in a total of 45s for the elongation time. This strategy was used after unsuccessfully targeting the annealing time which was seen in last weeks's work. The elongation time was also targeted since both partners achieved success in secondary PCR using this method. This is also due to the fact that the DNA sequence is 1407bp and may need longer time to finish elongating since it is quite large.
1162014- Include more picturesWeek 8,9 & 10
PCR trial 3 for target PF6PGD
Analysis
The third trial of PCR resulted in no bands as seen in Figure 1. In this trial, NEB guidelines were used for secondary PCR with the addition of 5 seconds to the highest numbers given for the annealing step (10-30s) which resulted in 35s for this step. Unfortunately their were no results seen after running the gel. In the fourth trial, NEB guidelines were also used along with the highest numbers for each step. In the fourth trial, the elongation step was targeted and an additional 15 seconds was added to the the step. Elongation step was targeted due to the fact that the sequence was quite large in length (1407 base pairs) and more time may be needed for this step. The elongation step also targeted because a lab partner had success using the same method. The gel has not been ran to confirm any results but will be ran at the beginning of the week.
9232014- Great analysis Lauren
Week 5,6 & 7
PCR trials 1 & 2 for target PF6PGD
Analysis:The first attempt at primary PCR failed as seen in lane 2 of Figure 1 which displayed no smear. In the second attempt at primary PCR, two samples were made and inserted into lanes 3 and 4 of the second gel as seen in Figure 2. Lane 4 showed a slight smear but was questioned due to the length of the smear and the fact that it was located heavily at the bottom which is not quite right for a 1407 base pair DNA sequence. Results will be confirmed after performing secondary PCR and rerunning the sample in lane 4. If a band appears in secondary PCR then the next step would be PCR squared for amplification, if not then adjustments must be made to the protocol such as the annealing temperature or possibly the annealing time since it is a large sequence.
Plasmid Midi-Prep for pNIC-Bsa4
Analysis:Midi-prep for pNIC-Bsa4 was performed in order to purify the plasmid for DNA cloning. An average yield of 26.5 ng/uL was obtained for plasmid pNIC-Bsa4 which is not ideal for the cloning the process. Error occurred when elution was plunged into the waste flask instead of the conical tube for collection. Half of the elution was lost before realizing the mistake which resulted in a low yield of plasmid. Midi-prep will be performed again in order to achieve the desired yield of ~50 ng/uL. After achieving a desirable yield of plasmid, the next step will to be to use it for RE digest.
Primer Tail Design
Forward Primer:
5' TACTTCCAATCCATGTGCGACATTGGTCTGAT 3'
Reverse Primer:
5' ACTATCATACCCTGTGGTAACAGTAAAGGTGGATA 3'
AnalysisA virtual plasmid was created using pNIC-Bsa4 and was digested with BsaI via NEBcutter in order to find where the insertion can be made for the CDS. After removal of SacB gene, the CDS can be inserted. Primer tails were also designed and ordered which will be needed for secondary PCR in order to create a full gene that can be amplified later for cloning.
09232014- Nice work, however you might want to elaborate more on your analysisWeek 3 & 4
Analysis:Agarose gel produced after PCR. Lane 2 missing due to error in loading lane. PCR
Agarose gel after RE digest using restriction enzymes to cut the plasmid producing different segments of the DNA.
RE Digest
Analysis
After overnight incubation and spin down, pellets (not pictured) were stored in the -20C freezer. The next step is the purification process.
Day 2 & 3 of Transformation: plasmid pNICBsa4
090814 - Good job Lauren.
Week 1 & 2
Analysis:
As seen if Figures 3 and 4, bacterial growth was present after overnight incubation. In order to confirm transformation, further analysis must be made. Next step in the process will be to over-express the protein.
Both graphs as seen in Figure 1 and 2 are consistent in illustrating peaks at 260nm which is the maximum wavelength DNA absorbs light at. Ratios at 260/280 are both close to 1.8, the desired ratio. These values indicate the purity in relation to protein which are both sufficient numbers. Ratios at 260/230 are also close to the number desired, 2.1 which correlates to the purity in relation to other contaminants. Both trials show fairly conclusive results.